Review



lta4h crispr guide rna  (Merck & Co)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Merck & Co lta4h crispr guide rna
    ( A ) Zebrafish neutrophils swarm at sites of tissue damage. Representative image illustrating neutrophils swarming (arrowhead) at the wound site following tail fin transection in 3dpf mpx:GFP larvae. Image was taken using 20× magnification on a TE2000U inverted microscope (Nikon). Time stamp shown is relative to the start of the imaging period at 30 min post injury and is h:mm:ss. 3D reconstruction time course illustrating neutrophils swarming at the wound site (swarm centre is highlighted by white asterisk). Imaging was performed using a 40× objective spinning disk confocal microscope (Perkin Elmer). Time stamps shown are relative to time post-injury and are in hh:mm:ss. ( B ) Representative image illustrating neutrophil swarming (arrowhead) in otic vesicle infected with S. aureus (magenta). Time stamps shown are hh:mm relative to time post infection. 3D reconstruction time course illustrating neutrophils swarming (swarm centre is highlighted by white asterisk) within the otic vesicle of 2dpf mpx:GFP larvae injected with 2500 cfu S. aureus SH1000 pMV158mCherry. Imaging was performed using a 20× objective spinning disk confocal microscope. Time stamps shown are hh:mm:ss relative to time post injection. ( C ) The percentage of tailfin transected larvae that had no swarms, transient swarms, or persistent swarms after 6hpi. Data shown are from n = 14 larvae from five biological replicates . ( D ) Area of neutrophil swarms measured at hourly intervals during the 5 hr imaging period. Error bars shown are mean ± SEM, n = 7 larvae with persistent swarms . ( E ) Distance time plot demonstrating the early recruitment of neutrophils proximal to the wound site (<350 μm) followed by the later recruitment of more distant neutrophils. Tracks are colour coded based on their average speed (µm/min). ( F ) CRISPR/Cas9-mediated knockdown of LTB4 signalling reduces late neutrophil recruitment. Neutrophil counts at the wound site in control tyr crRNA injected larvae (grey line), <t>lta4h</t> crRNA injected larvae (blue line), and blt1 crRNA injected larvae (green line) at 3 and 6 hpi. Error bars shown are mean ± SEM. Groups were analysed using a two-way ANOVA and adjusted using Sidak’s multi comparison test. **p<0.008 n = 45 accumulated from three biological repeats . Figure 1—source data 1. Numerical data for the graph of . Figure 1—source data 2. Numerical data for the graph of . Figure 1—source data 3. Numerical data for the graph of .
    Lta4h Crispr Guide Rna, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lta4h+crispr+guide+rna/lta4h/pmc08298094-35-8-6
    Average 90 stars, based on 1 article reviews
    lta4h crispr guide rna - by Bioz Stars, 2026-10
    90/100 stars

    Images

    1) Product Images from "Pioneer neutrophils release chromatin within in vivo swarms"

    Article Title: Pioneer neutrophils release chromatin within in vivo swarms

    Journal: eLife

    doi: 10.7554/eLife.68755

    ( A ) Zebrafish neutrophils swarm at sites of tissue damage. Representative image illustrating neutrophils swarming (arrowhead) at the wound site following tail fin transection in 3dpf mpx:GFP larvae. Image was taken using 20× magnification on a TE2000U inverted microscope (Nikon). Time stamp shown is relative to the start of the imaging period at 30 min post injury and is h:mm:ss. 3D reconstruction time course illustrating neutrophils swarming at the wound site (swarm centre is highlighted by white asterisk). Imaging was performed using a 40× objective spinning disk confocal microscope (Perkin Elmer). Time stamps shown are relative to time post-injury and are in hh:mm:ss. ( B ) Representative image illustrating neutrophil swarming (arrowhead) in otic vesicle infected with S. aureus (magenta). Time stamps shown are hh:mm relative to time post infection. 3D reconstruction time course illustrating neutrophils swarming (swarm centre is highlighted by white asterisk) within the otic vesicle of 2dpf mpx:GFP larvae injected with 2500 cfu S. aureus SH1000 pMV158mCherry. Imaging was performed using a 20× objective spinning disk confocal microscope. Time stamps shown are hh:mm:ss relative to time post injection. ( C ) The percentage of tailfin transected larvae that had no swarms, transient swarms, or persistent swarms after 6hpi. Data shown are from n = 14 larvae from five biological replicates . ( D ) Area of neutrophil swarms measured at hourly intervals during the 5 hr imaging period. Error bars shown are mean ± SEM, n = 7 larvae with persistent swarms . ( E ) Distance time plot demonstrating the early recruitment of neutrophils proximal to the wound site (<350 μm) followed by the later recruitment of more distant neutrophils. Tracks are colour coded based on their average speed (µm/min). ( F ) CRISPR/Cas9-mediated knockdown of LTB4 signalling reduces late neutrophil recruitment. Neutrophil counts at the wound site in control tyr crRNA injected larvae (grey line), lta4h crRNA injected larvae (blue line), and blt1 crRNA injected larvae (green line) at 3 and 6 hpi. Error bars shown are mean ± SEM. Groups were analysed using a two-way ANOVA and adjusted using Sidak’s multi comparison test. **p<0.008 n = 45 accumulated from three biological repeats . Figure 1—source data 1. Numerical data for the graph of . Figure 1—source data 2. Numerical data for the graph of . Figure 1—source data 3. Numerical data for the graph of .
    Figure Legend Snippet: ( A ) Zebrafish neutrophils swarm at sites of tissue damage. Representative image illustrating neutrophils swarming (arrowhead) at the wound site following tail fin transection in 3dpf mpx:GFP larvae. Image was taken using 20× magnification on a TE2000U inverted microscope (Nikon). Time stamp shown is relative to the start of the imaging period at 30 min post injury and is h:mm:ss. 3D reconstruction time course illustrating neutrophils swarming at the wound site (swarm centre is highlighted by white asterisk). Imaging was performed using a 40× objective spinning disk confocal microscope (Perkin Elmer). Time stamps shown are relative to time post-injury and are in hh:mm:ss. ( B ) Representative image illustrating neutrophil swarming (arrowhead) in otic vesicle infected with S. aureus (magenta). Time stamps shown are hh:mm relative to time post infection. 3D reconstruction time course illustrating neutrophils swarming (swarm centre is highlighted by white asterisk) within the otic vesicle of 2dpf mpx:GFP larvae injected with 2500 cfu S. aureus SH1000 pMV158mCherry. Imaging was performed using a 20× objective spinning disk confocal microscope. Time stamps shown are hh:mm:ss relative to time post injection. ( C ) The percentage of tailfin transected larvae that had no swarms, transient swarms, or persistent swarms after 6hpi. Data shown are from n = 14 larvae from five biological replicates . ( D ) Area of neutrophil swarms measured at hourly intervals during the 5 hr imaging period. Error bars shown are mean ± SEM, n = 7 larvae with persistent swarms . ( E ) Distance time plot demonstrating the early recruitment of neutrophils proximal to the wound site (<350 μm) followed by the later recruitment of more distant neutrophils. Tracks are colour coded based on their average speed (µm/min). ( F ) CRISPR/Cas9-mediated knockdown of LTB4 signalling reduces late neutrophil recruitment. Neutrophil counts at the wound site in control tyr crRNA injected larvae (grey line), lta4h crRNA injected larvae (blue line), and blt1 crRNA injected larvae (green line) at 3 and 6 hpi. Error bars shown are mean ± SEM. Groups were analysed using a two-way ANOVA and adjusted using Sidak’s multi comparison test. **p<0.008 n = 45 accumulated from three biological repeats . Figure 1—source data 1. Numerical data for the graph of . Figure 1—source data 2. Numerical data for the graph of . Figure 1—source data 3. Numerical data for the graph of .

    Techniques Used: Inverted Microscopy, Imaging, Microscopy, Infection, Injection, CRISPR

    ( A ) Single-cell gene expression profiles of LTB4 signalling components expressed in the zebrafish neutrophil lineage, extracted from the Sanger BASiCz zebrafish blood atlas. Circles represent individual cells colour coded where red is high expression and yellow is no expression. ( B ) Genotyping example of successful CRISPR-induced indels by high-resolution melt analysis for blt1 and lta4h sgRNA injected larvae. Wild-type curves (red) from three representative control tyrosinase larvae and shifted, irregular melt curves (green) corresponding to mosaic heteroduplex PCR fragments formed as a result of CRISPR/Cas9 mutations.
    Figure Legend Snippet: ( A ) Single-cell gene expression profiles of LTB4 signalling components expressed in the zebrafish neutrophil lineage, extracted from the Sanger BASiCz zebrafish blood atlas. Circles represent individual cells colour coded where red is high expression and yellow is no expression. ( B ) Genotyping example of successful CRISPR-induced indels by high-resolution melt analysis for blt1 and lta4h sgRNA injected larvae. Wild-type curves (red) from three representative control tyrosinase larvae and shifted, irregular melt curves (green) corresponding to mosaic heteroduplex PCR fragments formed as a result of CRISPR/Cas9 mutations.

    Techniques Used: Expressing, CRISPR, Injection


    Figure Legend Snippet:

    Techniques Used: Transgenic Assay, Infection, CRISPR, Sequencing, Recombinant, Plasmid Preparation, Software

    Related Articles

    CRISPR:

    Article Title: Pioneer neutrophils release chromatin within in vivo swarms
    Article Snippet: Software, algorithm , Volocity , Quorum Technologies , https://quorumtechnologies.com/volocity , . .. Other , lta4h Synthetic SynRNA , Merck , lta4h CRISPR guide RNA , AGGGTCTGAAACTGGAGTCA(TGG). .. Other , blt1 Synthetic SynRNA , Merck , blt1 CRISPR guide RNA , CAATGCCAATCTGATGGGAC(AGG).



    Similar Products

    lta4h crispr guide rna  (Merck & Co)
    90
    Merck & Co lta4h crispr guide rna
    ( A ) Zebrafish neutrophils swarm at sites of tissue damage. Representative image illustrating neutrophils swarming (arrowhead) at the wound site following tail fin transection in 3dpf mpx:GFP larvae. Image was taken using 20× magnification on a TE2000U inverted microscope (Nikon). Time stamp shown is relative to the start of the imaging period at 30 min post injury and is h:mm:ss. 3D reconstruction time course illustrating neutrophils swarming at the wound site (swarm centre is highlighted by white asterisk). Imaging was performed using a 40× objective spinning disk confocal microscope (Perkin Elmer). Time stamps shown are relative to time post-injury and are in hh:mm:ss. ( B ) Representative image illustrating neutrophil swarming (arrowhead) in otic vesicle infected with S. aureus (magenta). Time stamps shown are hh:mm relative to time post infection. 3D reconstruction time course illustrating neutrophils swarming (swarm centre is highlighted by white asterisk) within the otic vesicle of 2dpf mpx:GFP larvae injected with 2500 cfu S. aureus SH1000 pMV158mCherry. Imaging was performed using a 20× objective spinning disk confocal microscope. Time stamps shown are hh:mm:ss relative to time post injection. ( C ) The percentage of tailfin transected larvae that had no swarms, transient swarms, or persistent swarms after 6hpi. Data shown are from n = 14 larvae from five biological replicates . ( D ) Area of neutrophil swarms measured at hourly intervals during the 5 hr imaging period. Error bars shown are mean ± SEM, n = 7 larvae with persistent swarms . ( E ) Distance time plot demonstrating the early recruitment of neutrophils proximal to the wound site (<350 μm) followed by the later recruitment of more distant neutrophils. Tracks are colour coded based on their average speed (µm/min). ( F ) CRISPR/Cas9-mediated knockdown of LTB4 signalling reduces late neutrophil recruitment. Neutrophil counts at the wound site in control tyr crRNA injected larvae (grey line), <t>lta4h</t> crRNA injected larvae (blue line), and blt1 crRNA injected larvae (green line) at 3 and 6 hpi. Error bars shown are mean ± SEM. Groups were analysed using a two-way ANOVA and adjusted using Sidak’s multi comparison test. **p<0.008 n = 45 accumulated from three biological repeats . Figure 1—source data 1. Numerical data for the graph of . Figure 1—source data 2. Numerical data for the graph of . Figure 1—source data 3. Numerical data for the graph of .
    Lta4h Crispr Guide Rna, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lta4h+crispr+guide+rna/lta4h/pmc08298094-35-8-6
    Average 90 stars, based on 1 article reviews
    lta4h crispr guide rna - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    ( A ) Zebrafish neutrophils swarm at sites of tissue damage. Representative image illustrating neutrophils swarming (arrowhead) at the wound site following tail fin transection in 3dpf mpx:GFP larvae. Image was taken using 20× magnification on a TE2000U inverted microscope (Nikon). Time stamp shown is relative to the start of the imaging period at 30 min post injury and is h:mm:ss. 3D reconstruction time course illustrating neutrophils swarming at the wound site (swarm centre is highlighted by white asterisk). Imaging was performed using a 40× objective spinning disk confocal microscope (Perkin Elmer). Time stamps shown are relative to time post-injury and are in hh:mm:ss. ( B ) Representative image illustrating neutrophil swarming (arrowhead) in otic vesicle infected with S. aureus (magenta). Time stamps shown are hh:mm relative to time post infection. 3D reconstruction time course illustrating neutrophils swarming (swarm centre is highlighted by white asterisk) within the otic vesicle of 2dpf mpx:GFP larvae injected with 2500 cfu S. aureus SH1000 pMV158mCherry. Imaging was performed using a 20× objective spinning disk confocal microscope. Time stamps shown are hh:mm:ss relative to time post injection. ( C ) The percentage of tailfin transected larvae that had no swarms, transient swarms, or persistent swarms after 6hpi. Data shown are from n = 14 larvae from five biological replicates . ( D ) Area of neutrophil swarms measured at hourly intervals during the 5 hr imaging period. Error bars shown are mean ± SEM, n = 7 larvae with persistent swarms . ( E ) Distance time plot demonstrating the early recruitment of neutrophils proximal to the wound site (<350 μm) followed by the later recruitment of more distant neutrophils. Tracks are colour coded based on their average speed (µm/min). ( F ) CRISPR/Cas9-mediated knockdown of LTB4 signalling reduces late neutrophil recruitment. Neutrophil counts at the wound site in control tyr crRNA injected larvae (grey line), lta4h crRNA injected larvae (blue line), and blt1 crRNA injected larvae (green line) at 3 and 6 hpi. Error bars shown are mean ± SEM. Groups were analysed using a two-way ANOVA and adjusted using Sidak’s multi comparison test. **p<0.008 n = 45 accumulated from three biological repeats . Figure 1—source data 1. Numerical data for the graph of . Figure 1—source data 2. Numerical data for the graph of . Figure 1—source data 3. Numerical data for the graph of .

    Journal: eLife

    Article Title: Pioneer neutrophils release chromatin within in vivo swarms

    doi: 10.7554/eLife.68755

    Figure Lengend Snippet: ( A ) Zebrafish neutrophils swarm at sites of tissue damage. Representative image illustrating neutrophils swarming (arrowhead) at the wound site following tail fin transection in 3dpf mpx:GFP larvae. Image was taken using 20× magnification on a TE2000U inverted microscope (Nikon). Time stamp shown is relative to the start of the imaging period at 30 min post injury and is h:mm:ss. 3D reconstruction time course illustrating neutrophils swarming at the wound site (swarm centre is highlighted by white asterisk). Imaging was performed using a 40× objective spinning disk confocal microscope (Perkin Elmer). Time stamps shown are relative to time post-injury and are in hh:mm:ss. ( B ) Representative image illustrating neutrophil swarming (arrowhead) in otic vesicle infected with S. aureus (magenta). Time stamps shown are hh:mm relative to time post infection. 3D reconstruction time course illustrating neutrophils swarming (swarm centre is highlighted by white asterisk) within the otic vesicle of 2dpf mpx:GFP larvae injected with 2500 cfu S. aureus SH1000 pMV158mCherry. Imaging was performed using a 20× objective spinning disk confocal microscope. Time stamps shown are hh:mm:ss relative to time post injection. ( C ) The percentage of tailfin transected larvae that had no swarms, transient swarms, or persistent swarms after 6hpi. Data shown are from n = 14 larvae from five biological replicates . ( D ) Area of neutrophil swarms measured at hourly intervals during the 5 hr imaging period. Error bars shown are mean ± SEM, n = 7 larvae with persistent swarms . ( E ) Distance time plot demonstrating the early recruitment of neutrophils proximal to the wound site (<350 μm) followed by the later recruitment of more distant neutrophils. Tracks are colour coded based on their average speed (µm/min). ( F ) CRISPR/Cas9-mediated knockdown of LTB4 signalling reduces late neutrophil recruitment. Neutrophil counts at the wound site in control tyr crRNA injected larvae (grey line), lta4h crRNA injected larvae (blue line), and blt1 crRNA injected larvae (green line) at 3 and 6 hpi. Error bars shown are mean ± SEM. Groups were analysed using a two-way ANOVA and adjusted using Sidak’s multi comparison test. **p<0.008 n = 45 accumulated from three biological repeats . Figure 1—source data 1. Numerical data for the graph of . Figure 1—source data 2. Numerical data for the graph of . Figure 1—source data 3. Numerical data for the graph of .

    Article Snippet: Other , lta4h Synthetic SynRNA , Merck , lta4h CRISPR guide RNA , AGGGTCTGAAACTGGAGTCA(TGG).

    Techniques: Inverted Microscopy, Imaging, Microscopy, Infection, Injection, CRISPR

    ( A ) Single-cell gene expression profiles of LTB4 signalling components expressed in the zebrafish neutrophil lineage, extracted from the Sanger BASiCz zebrafish blood atlas. Circles represent individual cells colour coded where red is high expression and yellow is no expression. ( B ) Genotyping example of successful CRISPR-induced indels by high-resolution melt analysis for blt1 and lta4h sgRNA injected larvae. Wild-type curves (red) from three representative control tyrosinase larvae and shifted, irregular melt curves (green) corresponding to mosaic heteroduplex PCR fragments formed as a result of CRISPR/Cas9 mutations.

    Journal: eLife

    Article Title: Pioneer neutrophils release chromatin within in vivo swarms

    doi: 10.7554/eLife.68755

    Figure Lengend Snippet: ( A ) Single-cell gene expression profiles of LTB4 signalling components expressed in the zebrafish neutrophil lineage, extracted from the Sanger BASiCz zebrafish blood atlas. Circles represent individual cells colour coded where red is high expression and yellow is no expression. ( B ) Genotyping example of successful CRISPR-induced indels by high-resolution melt analysis for blt1 and lta4h sgRNA injected larvae. Wild-type curves (red) from three representative control tyrosinase larvae and shifted, irregular melt curves (green) corresponding to mosaic heteroduplex PCR fragments formed as a result of CRISPR/Cas9 mutations.

    Article Snippet: Other , lta4h Synthetic SynRNA , Merck , lta4h CRISPR guide RNA , AGGGTCTGAAACTGGAGTCA(TGG).

    Techniques: Expressing, CRISPR, Injection

    Journal: eLife

    Article Title: Pioneer neutrophils release chromatin within in vivo swarms

    doi: 10.7554/eLife.68755

    Figure Lengend Snippet:

    Article Snippet: Other , lta4h Synthetic SynRNA , Merck , lta4h CRISPR guide RNA , AGGGTCTGAAACTGGAGTCA(TGG).

    Techniques: Transgenic Assay, Infection, CRISPR, Sequencing, Recombinant, Plasmid Preparation, Software